Mental Retardation and Inborn Errors of Metabolism

The most common metabolic disease, and the first one to be treated by diet, is phenylketonuria (PKU).  PKU is a genetic disease in which a mutation in the enzyme phenylalanine hydroxylase (PAH) results in the inability to properly metabolize phenylalanine (Phe) into tyrosine.

This metabolic error causes a build up of phenylalanine which is converted to phenylpyruvate which is toxic.  Left untreated it causes problems in brain development resulting in mental retardation, brain damage and seizures.  At birth, babies appear normal then slowly deteriorate.  Prior to 1960 untreated PKU was the leading cause of mental retardation in the united states PKU facts.

Because newborn infants are asymptomatic, screening is conducted and PKU positive infants are started on a low PKU diet that is life long.  Foods containing phenylalanine have warning labels and are ubiquitous in the grocery store.

It's wild that a simple test and diet has eliminated a major causee of mental retardation

Dr. Miguel Tam and Plasmacytoid Dendritic Cells

Dr. Miguel Tam came to our class last Monday to talk about his research on CD2X regulation of INIF I production by plasmacytoid dendritic cells.

The innate immune system contain dentritic cells that can recognize harms from the environment.
Pathogenic Bacteria signals conventional dendritic cells that - stimulate effector functions.

There are two types of dendritic cells, plasmacytoid dendritic cells (pDC) and and conventional dendritic cells (cDC).  When a virus is recognized by a pDC, the cell produces type I interferons (IFN-I) which stimulates an antiviral response.

Dr. Tam's experiments were to determine the role of CD2X in the production of INF-I.

First, Dr. Tam was able to prove that pDC cells were able to express CD2X.

Second, Dr. Tam wanted to determine the role CD2X played in IFN-I production.  He was able to prove CD2X deficiency stimulates IFN-I production with the use of knockout mice.

Third, Dr. Tam wanted to determine the role of CD2X in an antiviral response so he infected knockout mice and WT mice with MCMV.  Both CD2X and IFN-I were expressed higher in CD2XKO mice.  50:50 chimera mice (CD2XKO and WT) were also exposed to MCMV and the KO cells produced more INF-I than WT.  The experiment was repeated with a different mouse virus and again the CD2XKO cells produced more IFN-I and Dr. Tam was able to conclude that CD2X had an effect on the production of IFN-I. 

Finally, Dr. Tam wanted to determine the mechanism for CD2X production of IFN-I.  A Src molecule is phosphorlated as one the the steps in a chain reaction for CD2X to produce IFN-I.

After all of the experiments were finished Dr. Tam was able to conclude that CD2X controls production in pDC cells and CD2X regulation of IFN-I has an effect on the viral load.  If CD2X is low, IFN-I is high.

IFN-I is involved in psoriasis and systemic Lupis.  Understanding the the mechanisms behind IFN-I could lead to better control and treatment of certain types of autoimmune diseases.

Afatinib and EGFR my other Metabolic pathway

Afatinib, planned trade name Tomtovok (previously Tovok), is undergoing a Phase III clinical trials for non-small cell lung carcinoma NSCLC), and was developed by Boehringer Ingelheim. 

Afatinib

Mechanism of action

Afatinib is a next generation tyrosine kinase inhibitor (TKI) that irreversibly inhibits human epidermal growth factor receptor 2 Her2 (ErbB2) and epidermal growth factor receptor EGFR (ErbB1) tyrosine kinases.

Conclusion

Afatinib monotherapy demonstrated encouraging activity in treatment-refractory NSCLC during clinical trials with squamous histology that merits further evaluation.

Two-component regulation of the gene PilA

GOAL: To research the regulatory pathways for the genes that expresses pili in Geobacter sulfurreducens.

1.   Abstract (proposed)

To determine the regulatory pathway and external factors that controls production of type IV pili in Geobacter sulfurreducens.   Geobacter sulfurreducens is a bacterium that can produce electricity and precipitates solid metals.  It contains type IV pili, which are the proposed mechanism that allows G. sulfurreducens to attach directly to Fe(III) oxide surfaces.   The gene PilA codes for type IV pili in Gram-negative bacteria.  A “Two-component regulatory system” regulates PilA.  In a two-component system, proteins sense then respond to environmental changes.  The sensor protein is a histidine kinase (HK) and the response regulator (RR) protein contains a phosphoryl group.  Once activated the RR can then effect changes in cellular physiology by regulating gene expression.

The proposed two-component for G. sulfurreducens are PilS a sensory box histidine kinase (HK) located on gene GSU1494 and PilR a sigma-54 dependent DNA-binding response regulator (RR) located on gene GSU1495.  The cascading signal from PilR activates RpoN a RNA polymerase sigma-54 that in turn activates PilA, a type IV pilus assembly protein.

Two-component pathway

Type IV pili have been extensively studied in other bacteria, but not Geobacter sulfurreducens.  An attempt will be made to correlate studies, primarily with Pseudomonas aeruginosa,  to help determine the factors that activate the two-component system in G. sulfurreducens.

2.  The goal of my BIO610 paper was to establish a connection between OmcS and its involvement with the bacteria’s pili.  The pili are needed for optimal bacterial growth.  This paper will attempt to ascertain the factors that influence the cell’s pili production.

3.  Areas that need improvement are writing in scientific format, not using terms that are overly familiar and keeping the flow of information organized to tell a coherent story.

4.  References:

(Kanehisa_Laboratories). (2012). Two-component system - Geobacter sulfurreducens. KEGG: Kyoto Encyclopedia of Genes and Genomes. Retrieved from http://www.genome.jp/kegg-bin/show_pathway?gsu02020+M00501

Leang, C., Krushkal, J., Ueki, T., Puljic, M., Sun, J., Juárez, K., Núñez, C., et al. (2009). Genome-wide analysis of the RpoN regulon in Geobacter sulfurreducens. BMC genomics, 10(Iii), 331. doi:10.1186/1471-2164-10-331

Potvin, E., Sanschagrin, F., & Levesque, R. C. (2008). Sigma factors in Pseudomonas aeruginosa. FEMS microbiology reviews, 32(1), 38-55. doi:10.1111/j.1574-6976.2007.00092.x

Sigma-Aldrich. (2012). Mucin. Sigma Aldrich Life Sciences. Retrieved from http://www.sigmaaldrich.com/life-science/metabolomics/enzyme-explorer/learning-center/structural-proteins/mucin.html

Tremblay, P.-L., Aklujkar, M., Leang, C., Nevin, K. P., & Lovley, D. (2012). A genetic system for Geobacter metallireducens: role of the flagellin and pilin in the reduction of Fe(III) oxide. Environmental Microbiology Reports, 4(1), 82-88. doi:10.1111/j.1758-2229.2011.00305.x

UniPort. (2012). Two-component regulatory system. UniPort, Keywords. Retrieved from http://www.uniprot.org/keywords/902

My favorite metabolic pathway is the production of siroheme

Siroheme

My favorite metabolic pathway is the production of siroheme in Geobacter sulfurreducens.

Sulphur (S) and nitrogen (N) are essential elements for all life. In plants and bacteria, sulfur is mainly taken up from the soil as sulphate and can be metabolized into the essential amino acids cystine and methionine. 

Animals cannot reduce reduce sulphate and cannot produce these two amino acids.  The essential sulfur containing amino acids cysteine and methionine must be taken in by diet (Tripathy, Sherameti, & Oelmüller, 2010)





Siroheme is a porphyrin.  Porphyrins are synthesized in the mitochondria and cytosol although there is some variation where the steps occur  between organisms.  Some steps may take place in  the mitochondria is one and cytosol in the other. 

They begin as simple amino acids and can form by one of two routes. Siroheme synthesis in G. sulfurreducens begins at the C5 pathway and starts out as glutamate. Porphyrin synthesis occurs along the Shemin pathway and is very conserved throughout all domains of life (Piao, Kiatpapan, Yamashita, & Murooka, 2004).

Siroheme pathway

(Tanaka & Tanaka, 2007)

Siroheme synthesis diverges from the Shemin pathway at step six at the heme precursor uroporphyrinogen III (Urogen III).  Siroheme synthesis plays a major role in converting sulfite to a biologically useful sulfide, which can be incorporated into the organic compound homocysteine (“Siroheme,” 2011).

The metabolic pathway for siroheme synthesis was downloaded from Kyoto Encyclopedia of Genes and Genomes from the porphyrin synthesis pathway (KEGG).



Siroheme pathway



The pathway for our discussion will begin at 5-aminolevulinate or δ-aminolevulinic acid (ALA).  There are at least five genes involved in the production, HemL, HemB, HemC, HemD, and CysG that produce the enzymes for siroheme synthesis.

Step 1       

1a. The first step in siroheme synthesis involves the condensation of glutamate (C-5 pathway) with succinylcoenzyme A (succinyl-CoA), which forms δ-aminolevulinic acid (ALA). In all organisms that produce heme, aminolevulinic acid synthase (ALAS) catalyzes the production of ALA.  ALAS uses vitamin B6, pyridoxal 5- phosphate, as a cofactor.

1b.  Following synthesis, ALA is exported from the mitochondria by an unknown

mechanism.  Two molecules of ALA are converted to porphobilinogen (PBG) in a condensation reaction catalyzed by aminolevulinic acid dehydratase (ALAD) (HemB).   ALAD from plants and many bacteria requires magnesium as a co-facter. 

PBG is the pyrrole precursor utilized by all living systems for the biosynthesis of tetrapyrroles, including hemes, chlorophylls, and corrins.

Step 2        

Four PBG molecules are combined to form a cyclic tetrapyrrole. This is done with the help of two enzymes.  Porphobilinogen deaminase (PBGD) and hydroxymethylbilane synthase (HMBS) (HemC) catalyzes the formation of the linear tetrapyrrole – hydroxymethylbilane (HMB) – from four molecules of PBG.

Step 3

HMB is unstable and is quickly converted by methylation to uroporphyrinogen III (UROgenIII) by uroporphyrinogen III synthase (UROS) (HemD). UROS catalyzes ring closure to form an asymmetrical macrocycle. 

**Here porphyrin synthesis diverges for different synthesis pathways, such as heme, siroheme, chlorophyll, and phytochromobilin.

**Methylation drives the reaction towards siroheme synthesis, **decarboxylation steers the reaction toward heme and chlorophyll synthesis (Tripathy et al., 2010).

Step 4

Uroporphyrinogen III is methylated twice with uroporphyrinogen III methyltransferase (Upm) (CysG) into precorrin 2 for siroheme synthesis.

**Decarboxylation by uroporphyrinogen III decarboxylase drives the reaction towards coproporphyrinogen III leading to chlorophyll and heme biosynthesis.

Step 5

Precorrin 2 is dehydrogenated by the enzyme precorrin-2 dehydrogenase (CysG) to form sirohydrochlorin.

Step 6

Iron (Fe+2) is inserted to the center of the tetrapyrrole with the enzyme sirohydrochlorin ferrochelatase (CysG) to form siroheme (Tripathy et al., 2010). 

Regulation:
I have not found any literature for the regulation of siroheme.  Siroheme is an iron-containing isobacteriochlorin essential for nitrite and sulfite reduction reactions (Severance & Hamza, 2009).

Bibliography

(Kanehisa_Laboratories). (2011). Porphyrin and chlorophyll metabolism - Geobacter sulfurreducens. KEGG: Kyoto Encyclopedia of Genes and Genomes. Retrieved September 5, 2012, from http://www.genome.jp/kegg-bin/show_pathway?gsu00860

Piao, Y., Kiatpapan, P., Yamashita, M., & Murooka, Y. (2004). Effects of expression of hemA and hemB genes on production of porphyrin in Propionibacterium freudenreichii. Applied and environmental microbiology, 70(12), 7561-6. doi:10.1128/AEM.70.12.7561-7566.2004

Severance, S., & Hamza, I. (2009). Trafficking of heme and porphyrins in metazoa. Chemical reviews, 109(10), 4596-4616. doi:10.1021/cr9001116.Trafficking

Siroheme. (2011).Wikipedia. Retrieved November 5, 2012, from http://en.wikipedia.org/wiki/Siroheme

Tanaka, R., & Tanaka, A. (2007). Tetrapyrrole biosynthesis in higher plants. Annual review of plant biology, 58, 321-46. doi:10.1146/annurev.arplant.57.032905.105448

Tripathy, B. C., Sherameti, I., & Oelmüller, R. (2010). Siroheme: an essential component for life on earth. Plant signaling & behavior, 5(1), 14-20. Retrieved from http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2835951&tool=pmcentrez&rendertype=abstract

(Kanehisa_Laboratories). (2011). Porphyrin and chlorophyll metabolism - Geobacter sulfurreducens. KEGG: Kyoto Encyclopedia of Genes and Genomes. Retrieved September 5, 2012, from http://www.genome.jp/kegg-bin/show_pathway?gsu00860

Piao, Y., Kiatpapan, P., Yamashita, M., & Murooka, Y. (2004). Effects of expression of hemA and hemB genes on production of porphyrin in Propionibacterium freudenreichii. Applied and environmental microbiology, 70(12), 7561-6. doi:10.1128/AEM.70.12.7561-7566.2004

Severance, S., & Hamza, I. (2009). Trafficking of heme and porphyrins in metazoa. Chemical reviews, 109(10), 4596-4616. doi:10.1021/cr9001116.Trafficking

Siroheme. (2011).Wikipedia. Retrieved November 5, 2012, from http://en.wikipedia.org/wiki/Siroheme

Tripathy, B. C., Sherameti, I., & Oelmüller, R. (2010). Siroheme: an essential component for life on earth. Plant signaling & behavior, 5(1), 14-20. Retrieved from http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2835951&tool=pmcentrez&rendertype=abstract

Dr. Ryder Frozen Zoo

Dr. Ryder, a professor of molecular biology at the San Diego Zoo Institute for Conservation, is a unique individual.  I was quite impressed with his background and education.  When he started school Watson and Crick were talking about something about DNA, whatever that was.  Then Watson and Crick determined DNA was a double helix.  In Dr. Ryder’s lifetime, our “molecules of life” was determined to be DNA arranged in a double helix, the concept of genes was developed and cell biology went from its infancy to the complex systems we know today.

Currently Dr. Ryder works at the “Frozen Zoo,” part of the San Diego zoo, sequencing animal genomes.  He stated, “The power of the genome was to be able to determine the genomic differences in populations.”  However, to know what is different, a baseline of “normal” has to be established. 

His work has been integrated with the California Condor Project.  At one time the population was down to 21 animals.  Some of the chicks were being born with lethal dwarfism.  It is a recessive gene and the Zoo did not want to pass on the recessive gene.  Dr. Ryder and his group have sequenced the genomes of the Zoo’s condor population in hopes to determine which animals carry the recessive gene.

Dr. Ryder’s work on the California Condor Project (and others) was an elegant example of how scientists working in the lab can have a direct impact on ecology and conservation.

It's A Long Way From Amphioxus IALWTA

Click here to listen

Oh, a fish-like thing appeared among the annelids one day,
It hadn't any parapods or setae to display.
It hadn't any eyes or jaws or ventral nervous chord.
But it had a lot of gill slits and it had a notochord.

Chorus:
It's a long way from amphioxus, it's a long way to us.
It's a long way from amphioxus to the meanest human cuss.
It's good-bye to fins and gill slits, and welcome lungs and hair.
It's a long, long way from amphioxus, but we all came from there.

It wan't much to look at and it scarce knew how to swim.
And Nories was very sure it hadn't come from him.
The Molluscs wouldn't own it and the Arthropods got sore.
So the poor thing had to burrow in the sand along the shore.

 Chorus

 He burrowed in the sand before a crab could nip his tail.
And he said, "Gill slits and myotomes are all to no avail."
"I've grown some metapleural folds and sport an oral hood.
But all these fine new characters don't do me any good."

 Chorus

He sulked awhile down in the sand, without a bit of pep;
Then he stiffened up his notochord and said, "I'll beat 'em yet!"
"Let them laugh and show their ignorance, I don't mind their jeers."
"Just wait until they see me in a hundred million years."

 Chorus

"My notochord shall change into a chain of vertebra,
And, as fins, my metapleural folds will agitate the sea."
"My tiny dorsal nervous chord shall be a mighty brain.
And the vertebrates shall dominate the animal domain."

Mitochondria and Disease

CARTOONS - The RIP-LCMV Model for Type 1 Diabetes

Attached is some really neat info on RIP-LCMV mice.  RIP-LCMV Mouse Model

 The RIP-LCMV mouse model was created to break tolerance to a defined target autoantigen expressed by b-cells through a viral infection. Such a target antigen represents a component of ‘self’ and therefore the host is ignorant or tolerant to that antigen.

Initiation of autoimmunity by virus-infection is twofold: First, the infection causes an activation of the innate immune system resulting in an inflammatory response involving the release of chemokines and cytokines. Those inflammatory factors in turn attract and activate leukocytes to the site of infection in a non-specific manner. Second, the presence of an identical antigen on both the b-cells and the infecting virus focuses this non-specific innate immune response specifically on the target antigen and thus breaks self-tolerance. Hence, after elimination of the intruding virus, the awakened immune response concentrates on the remaining transgenic target antigen expressed by the b-cells resulting in T1D. This scenario was experimentally reconstructed in the labs of Michael Oldstone (Scripps, La Jolla, CA) (Oldstone et al. (1991) Cell 65: 319-331) and Rolf Zinkernagel (Zurich, Switzerland) (Ohashi et al (1991) Cell 65: 305-317) in the early 1990’s.

By using the rat insulin promoter (RIP) they created transgenic mice whose pancreatic b-cells expressed either the nucleoprotein (NP) or the glycoprotein (GP) of LCMV as defined target antigens. Expression of either target antigen per se does not lead to b-cell dysfunction, islet cell infiltration, hyperglycemia, or spontaneous activation of autoreactive lymphocytes. However, infection with LCMV results in T1D in >95% of RIP-LCMV mice.  

Just as proposed for human T1D, the onset of diabetes in RIP-LCMV mice depends on the action of both, autoreactive CD4 and CD8 T-cells and correlates with the numbers of auto-aggressive lymphocytes generated. In accordance, the incidence of disease varied between the individual transgenic lines ranging from 2 weeks (RIP-GP lines) to 1-6 months (RIP-NP lines). Further studies revealed the mechanism involved in the rapid compared to the slow onset diabetes: Transgenic lines expressing the LCMV-GP transgene exclusively in the b-cells of the islets manifested rapid-onset T1D (10-14 days after viral challenge). In these lines the high systemic numbers of auto-aggressive CD8 T-cells were sufficient to induce diabetes and did not require help from CD4 cells. In contrast, in lines expressing the LCMV-NP transgene in both the b-cells and in the thymus, T1D took longer to occur after subsequent LCMV challenge. Several lines of evidence indicated that in RIP-NP mice the anti-self (viral) CTL were of lower affinity and that CD4 T-cells were essential to generate anti-self (viral) CD8 lymphocyte-mediated T1D. In addition, mouse models in which transgene-encoded ‘target-antigens’ are expressed in the pancreatic b-cells, such as the RIP-LCMV and the INS-HA mouse, have demonstrated that the presence of autoaggressive T-cells alone is not enough to cause disease. Unspecific ‘bystander factors’, such as cytokines and chemokines generated during the acute inflammation after LCMV infection, are important to drive the autoaggressive response (b-cell destruction) in ‘antigen-specific’ models for T1D.

Figure 2: Fast vs. slow onset model for type 1 diabetes

LCMV-GP is not expressed in the thymus of RIP-LCMV-GP mice and thus, LCMV-GP-specific CD8 T-cells of high affinity are released into the periphery resulting in fast destruction of LCMV-GP expressing beta-cells upon LCMV-infection and subsequently a fast-onset diabetes. In contrast, expression of LCMV-NP within the thymus of RIP-LCMV-NP mice induces the deletion of autoaggressive CD8 T-cells with high affinity. Only LCMV-NP-specific CD8 T-cells of low- or medium affinity are released into the periphery. Therefore the destrcution process of the insulin-producing beta-cell is delayed and depends on CD4 T-cell help resulting in a slow-onset type of diabetes.

COOL CARTOON

Figure 3: Immunopathogenic events following LCMV-infection in the RIP-LCMV model

LCMV-infection of the pancreas causes the release of ‘pro-inflammatory’ cytokines, such as TNFa, by resident macrophages. In turn, chemokines are released by activated endothelial cells as well as b-cells. Among them CXCL10 is the earliest chemokine to be expressed leading to high local concentrations at a very early time after LCMV-infection. CXCL10 predominantly attracts activated T-cells of the more aggressive Th-1 phenotype, which migrate into the inflamed tissue. Infiltrating LCMV-specific T-cells start destroying some b-cells in a perforin dependent manner. At a later stage further presentation of LCMV- and other islet antigens by professional antigen presenting cells, such as dendritic cells (DCs) leads to further proliferation and expansion of the autoaggressive T-cell repertoire. Islet antigen-specific, aggressive T-cells together with unspecific bystander factors destroy most of the remaining b-cells resulting in overt diabetes.

CLONING ASSIGNMENT

This is my next posting in my FECHing series.  Today's assignemnt is cloning the FECH protein from its gene.  The NCBI data base was used to look up the protein sequence within the gene.  They are highlighted in red.

FECH ferrochelatase [ Homo sapiens ]

NCBI Reference Sequence: NM_001012515.2

Primer Blast was used to pick some primers.  I had to narrow the search for the forward primers from 40 to 80 and from 1410 to 1480 on the reverse.

The primers provided by the Primer Blast program were:

Forward primer  1   CCACTGCTGGGCGGACACCT  20
Template          47  ......................................................  66

Reverse primer      1     TTGCCTAACGCCACGGGGTC  20
Template        1439  ........................................................  1420

They are highlighted in yellow.

1	aggtcagggg	gctggggacg	cgcgtgggga	tcgctacccg	gctcggccac	tgctgggcgg
61	acacctgggc	gcgccgccgc	gggaggagcc	cggactcggg	ccgaggctgc	ccaggcaatg
121	cgttcactcg	gcgcaaacat	ggctgcggcc	ctgcgcgccg	cgggcgtcct	gctccgcgat
181	ccgctggcat	ccagcagctg	gagggtctgt	cagccatgga	ggtggaagtc	aggtgcagct
241	gcagcggccg	tcaccacaga	aacagcccag	catgcccagg	gtgcaaaacc	tcaagttcaa
301	ccgcagaaga	ggtatgagtc	taacatcagg	aagccgaaaa	ctggaatatt	aatgctaaac
361	atgggaggcc	ctgaaactct	tggagatgtt	cacgacttcc	ttctgagact	cttcttggac
421	cgagacctca	tgacacttcc	tattcagaat	aagctggcac	cattcatcgc	caaacgccga
481	acccccaaga	ttcaagagca	gtaccgcagg	attggaggcg	gatcccccat	caagatatgg
541	acttccaagc	agggagaggg	catggtgaag	ctgctggatg	aattgtcccc	caacacagcc
601	cctcacaaat	actatattgg	atttcggtac	gtccatcctt	taacagaaga	agcaattgaa
661	gagatggaga	gagatggcct	agaaagggct	attgctttca	cacagtatcc	acagtacagc
721	tgctccacca	caggcagcag	cttaaatgcc	atttacagat	actataatca	agtgggacgg
781	aagcccacga	tgaagtggag	cactattgac	aggtggccca	cacatcacct	cctcatccag
841	tgctttgcag	atcatattct	aaaggaactg	gaccattttc	cacttgagaa	gagaagcgag
901	gtggtcattc	tgttttctgc	tcactcactg	cccatgtctg	tggtcaacag	aggcgaccca
961	tatcctcagg	aggtaagcgc	cactgtccaa	aaagtcatgg	aaaggctgga	gtactgcaac
1021	ccctaccgac	tggtgtggca	atccaaggtt	ggtccaatgc	cctggttggg	tcctcaaaca
1081	gacgaatcta	tcaaagggct	ttgtgagagg	gggaggaaga	atatcctctt	ggttccgata
1141	gcatttacca	gtgaccatat	tgaaacgctg	tatgagctgg	acatcgagta	ctctcaagtt
1201	ttagccaagg	agtgtggagt	tgaaaacatc	agaagagctg	agtctcttaa	tggaaatcca
1261	ttgttctcta	aggccctggc	cgacttggtg	cattcacaca	tccagtcaaa	cgagctgtgt
1321	tccaagcagc	tgaccctgag	ctgtccgctc	tgtgtcaatc	ctgtctgcag	ggagactaaa
1381	tccttcttca	ccagccagca	gctgtgaccc	ccgccggtgg	accccgtggc	gttaggcaaa
1441	tgcccaacct	ccagatacct	ccgatgtgga	gagggtgtta	tttagagatc	aaggaaggaa
1501	gtcatccttc	cttgatatat	atacagcctt	tgggtacaaa	ttgtgtggtt	tcttgaggat
1561	tggactcttg	atggatttct	atttttatat	aactatacag	taagcatttg	tattttctct
	http://www.ncbi.nlm.nih.gov/nuccore/189181657

This is the map of restriction enzymes provided by NEBcutter. Unfortunately the only forward restriction enzyme usable was AvaI and it was not listed in any of the vectors in New England BioLabs collection and the use of the primers from Primer Blast will be used and a restriction enzyme will be attached.

The vector I will be using is pCLIPf. It is listed on the web site and should work with my project.  The plasmid has two multiple cloning sites MCS1 and MCS2.  A group of fairly common restriction enzymes are in the MCS1 location.  Primer ECorRV looks to ba a good choice for the forward promer and EcoRI is a good choice for the reverse primer.

New England BioLabs desribes pCLIP as thus:

"pCLIP_f Vector is a mammalian expression plasmid intended for the cloning and stable or transient expression of CLIP-tag® protein fusions in mammalian cells. This plasmid encodes CLIP_f, a CLIP-tag protein, which is expressed under control of the CMV promoter. The expression vector has an IRES (internal ribosome entry site) and a neomycin resistance gene downstream of the CLIP_f for the efficient selection of stable transfectants. pCLIP_f Vector contains two multiple cloning sites to allow cloning of the fusion partner as a fusion to the N- or C-terminus of the CLIP_f.

The CLIP-tag is a novel tool for protein research, allowing the specific, covalent attachment of virtually any molecule to a protein of interest. The CLIP-tag is a small polypeptide based on human O⁶-alkylguanine-DNA-alkyltransferase (hAGT). CLIP-tag substrates are derivatives of benzyl cytosine (BC). In the labeling reaction, the substituted benzyl group of the substrate is covalently attached to the reactive cysteine of CLIP-tag forming a stable thioether link."



PCR primers EcoRV will be inserted on the forward strand and EcoRI will be inserted on the reverse strand.
Forward: GATATCCCACTGCTGGGCGGACACCT
Reverse: GAATTTTGCCTAACGCCACGGGGTC