CLONING ASSIGNMENT

This is my next posting in my FECHing series.  Today's assignemnt is cloning the FECH protein from its gene.  The NCBI data base was used to look up the protein sequence within the gene.  They are highlighted in red.

FECH ferrochelatase [ Homo sapiens ]

NCBI Reference Sequence: NM_001012515.2

Primer Blast was used to pick some primers.  I had to narrow the search for the forward primers from 40 to 80 and from 1410 to 1480 on the reverse.

The primers provided by the Primer Blast program were:

Forward primer  1   CCACTGCTGGGCGGACACCT  20
Template          47  ......................................................  66

Reverse primer      1     TTGCCTAACGCCACGGGGTC  20
Template        1439  ........................................................  1420

They are highlighted in yellow.

1	aggtcagggg	gctggggacg	cgcgtgggga	tcgctacccg	gctcggccac	tgctgggcgg
61	acacctgggc	gcgccgccgc	gggaggagcc	cggactcggg	ccgaggctgc	ccaggcaatg
121	cgttcactcg	gcgcaaacat	ggctgcggcc	ctgcgcgccg	cgggcgtcct	gctccgcgat
181	ccgctggcat	ccagcagctg	gagggtctgt	cagccatgga	ggtggaagtc	aggtgcagct
241	gcagcggccg	tcaccacaga	aacagcccag	catgcccagg	gtgcaaaacc	tcaagttcaa
301	ccgcagaaga	ggtatgagtc	taacatcagg	aagccgaaaa	ctggaatatt	aatgctaaac
361	atgggaggcc	ctgaaactct	tggagatgtt	cacgacttcc	ttctgagact	cttcttggac
421	cgagacctca	tgacacttcc	tattcagaat	aagctggcac	cattcatcgc	caaacgccga
481	acccccaaga	ttcaagagca	gtaccgcagg	attggaggcg	gatcccccat	caagatatgg
541	acttccaagc	agggagaggg	catggtgaag	ctgctggatg	aattgtcccc	caacacagcc
601	cctcacaaat	actatattgg	atttcggtac	gtccatcctt	taacagaaga	agcaattgaa
661	gagatggaga	gagatggcct	agaaagggct	attgctttca	cacagtatcc	acagtacagc
721	tgctccacca	caggcagcag	cttaaatgcc	atttacagat	actataatca	agtgggacgg
781	aagcccacga	tgaagtggag	cactattgac	aggtggccca	cacatcacct	cctcatccag
841	tgctttgcag	atcatattct	aaaggaactg	gaccattttc	cacttgagaa	gagaagcgag
901	gtggtcattc	tgttttctgc	tcactcactg	cccatgtctg	tggtcaacag	aggcgaccca
961	tatcctcagg	aggtaagcgc	cactgtccaa	aaagtcatgg	aaaggctgga	gtactgcaac
1021	ccctaccgac	tggtgtggca	atccaaggtt	ggtccaatgc	cctggttggg	tcctcaaaca
1081	gacgaatcta	tcaaagggct	ttgtgagagg	gggaggaaga	atatcctctt	ggttccgata
1141	gcatttacca	gtgaccatat	tgaaacgctg	tatgagctgg	acatcgagta	ctctcaagtt
1201	ttagccaagg	agtgtggagt	tgaaaacatc	agaagagctg	agtctcttaa	tggaaatcca
1261	ttgttctcta	aggccctggc	cgacttggtg	cattcacaca	tccagtcaaa	cgagctgtgt
1321	tccaagcagc	tgaccctgag	ctgtccgctc	tgtgtcaatc	ctgtctgcag	ggagactaaa
1381	tccttcttca	ccagccagca	gctgtgaccc	ccgccggtgg	accccgtggc	gttaggcaaa
1441	tgcccaacct	ccagatacct	ccgatgtgga	gagggtgtta	tttagagatc	aaggaaggaa
1501	gtcatccttc	cttgatatat	atacagcctt	tgggtacaaa	ttgtgtggtt	tcttgaggat
1561	tggactcttg	atggatttct	atttttatat	aactatacag	taagcatttg	tattttctct
	http://www.ncbi.nlm.nih.gov/nuccore/189181657

This is the map of restriction enzymes provided by NEBcutter. Unfortunately the only forward restriction enzyme usable was AvaI and it was not listed in any of the vectors in New England BioLabs collection and the use of the primers from Primer Blast will be used and a restriction enzyme will be attached.

The vector I will be using is pCLIPf. It is listed on the web site and should work with my project.  The plasmid has two multiple cloning sites MCS1 and MCS2.  A group of fairly common restriction enzymes are in the MCS1 location.  Primer ECorRV looks to ba a good choice for the forward promer and EcoRI is a good choice for the reverse primer.

New England BioLabs desribes pCLIP as thus:

"pCLIP_f Vector is a mammalian expression plasmid intended for the cloning and stable or transient expression of CLIP-tag® protein fusions in mammalian cells. This plasmid encodes CLIP_f, a CLIP-tag protein, which is expressed under control of the CMV promoter. The expression vector has an IRES (internal ribosome entry site) and a neomycin resistance gene downstream of the CLIP_f for the efficient selection of stable transfectants. pCLIP_f Vector contains two multiple cloning sites to allow cloning of the fusion partner as a fusion to the N- or C-terminus of the CLIP_f.

The CLIP-tag is a novel tool for protein research, allowing the specific, covalent attachment of virtually any molecule to a protein of interest. The CLIP-tag is a small polypeptide based on human O⁶-alkylguanine-DNA-alkyltransferase (hAGT). CLIP-tag substrates are derivatives of benzyl cytosine (BC). In the labeling reaction, the substituted benzyl group of the substrate is covalently attached to the reactive cysteine of CLIP-tag forming a stable thioether link."



PCR primers EcoRV will be inserted on the forward strand and EcoRI will be inserted on the reverse strand.
Forward: GATATCCCACTGCTGGGCGGACACCT
Reverse: GAATTTTGCCTAACGCCACGGGGTC